aids pomoc

Po znieczuleniu Nembutalem (Abbott Laboratories, North Chicago, Illinois, USA) tętnicę szyjną podwiązano w pobliżu rozwidlenia tętnic szyjnych, jak opisali Kumar i Lindner (20). W badaniu pompy, białko MK w roztworze soli (0,8 mg / ml) (n = 10), albumina ludzka (Wako Pure Chemical Industries, Osaka, Japonia) w roztworze soli (0,8 mg / ml) (n = 10) lub sól fizjologiczna ( n = 10) wlewano za pomocą pompy osmotycznej (Alza Corporation, Palo Alto, California, USA) myszom z niedoborem MK. Pompy napełniały w sumie 90. L w sposób ciągły przez okres 7 dni. Pompki wszczepiono pod skórę brzucha i wymieniono 7 dni po początkowej implantacji. Poziom cholesterolu i profil lipoprotein w surowicy określono w SRL Inc. (Tokio, Japonia) z zestawami do użytku klinicznego. Morfometria tętnic myszy. Stopień proliferacji śródbłonka oceniano ilościowo, badając 10 przekrojów hematoksyliny i eozyny w poprzek każdej lewej tętnicy szyjnej w odległości 5 mm od miejsca ligacji, jak opisali Kumar i Lindner (20). Obwody zewnętrznej warstwy elastycznej, wewnętrznej warstwy elastycznej i światła oraz obszary błony wewnętrznej i środkowej zmierzono za pomocą C. Imaging Series Simple (Compix Inc., Tualatin, Oregon, USA). Analizę statystyczną przeprowadzono za pomocą testu Manna-Whitneya. Białko i przeciwciała MK. Aby wytworzyć ludzkie białko MK, wektor ekspresji dla drożdży (Pichia pastoris GS115, Research Corporation Technologies, Tucson, Arizona, USA) skonstruowano przez wstawienie fragmentu cDNA pokrywającego otwartą ramkę odczytu ludzkiego MK (21) do pHIL-D4 (Invitrogen , Carlsbad, Kalifornia, USA). Po transfekcji wektora ekspresyjnego do drożdży przeprowadzono selekcję za pomocą histydyny i G418. Ludzkie białko MK oczyszczono z drożdży za pomocą chromatografii anionowymiennej i chromatografii powinowactwa na kolumnie heparynowej. Oczyszczone ludzkie białko wykazywało aktywność neurotroficzną porównywalną do aktywności mysiego MK wytwarzanego w komórkach L (22). Przeciwciała przeciwko mysiej bakterii wytwarzanej przez MK (23) wzbudzono przez wstrzyknięcie oczyszczonego białka do królików i oczyszczono za pomocą połączenia chromatografii powinowactwa na kolumnach z białkiem A i MK (23). Przeciwciała były specyficzne dla MK i nie reagowały na PTN / HB-GAM. PCR. Jeden mikrogram całkowitego RNA został poddany odwrotnemu transkrypcji przez Superscript II (GIBCO BRL, Rockville, Maryland, USA). Próbki denaturowano w 94 ° C przez minutę; PCR przeprowadzono dla 28 cykli 30 sekund w 94 ° C, 30 sekund w 55 ° C i 30 sekund w 72 ° C. Oligonukleotydy stosowane do amplifikacji były następujące: sekwencja cDNA szczurzego MK (numer dostępowy EMBL / banku genów AB025023) została wykorzystana do zaprojektowania oligonukleotydów dla MK: forward, ATGCAGCACCGAAGTTTCTTC; reverse, TCAGTCCTTT CCTTTTCCTTT. Dla szczurzego GAPDH: forward, GACCACAGTCCATGCCATCAC; reverse, GTAGCCGTATTCATTGTCATACC. Konkurencyjną PCR MK i GAPDH przeprowadzono przy użyciu zestawu do konstruowania DNA kompetycyjnego (Takara, Osaka, Japonia) zgodnie z protokołem producenta. Analiza Western blotting. Białka wyekstrahowane z tętnic szyjnych, które odpowiadały oryginalnej masie 10 mg, oddzielono 15% SDS-PAGE. Białko MK wykrywano metodą Western blotting z przeciwciałem przeciwko mysiemu MK stosując zestaw ECL (Amersham, Buckinghamshire, Wielka Brytania) (19). Próbki histologiczne. Tętnice tętnic szyjnych utrwalono 4% paraformaldehydem, zatopiono w parafinie i pocięto na sekcje o długości 5 urn. Aby wytworzyć 5-. M krioskrawki tętnic szyjnych, myszy perfundowano 3,0% paraformaldehydem w PBS i tkanki przepłukano przez noc w 20% sacharozie przed osadzeniem w związku OCT (Tissue-Tek, Torrance, California, USA). Immunohistochemia. Procedura immunobarwienia MK w sekcjach parafinowych była taka, jak opisano poprzednio (24).
[podobne: kątnica jelita grubego, ashwagandha skutki uboczne, olej rydzowy właściwości ]