Ekspresja Bcl-x w prekursorach erytroidalnych od pacjentów z czerwienicą prawdziwą cd

Komórki hodowano w obecności lub nieobecności 3 U erytropoetyny na mililitr i inkubowano do czasu, gdy CFU-E oceniano w dniu 7. Komórki erytroidalne następnie inkubowano w ciekłej hodowli (zmodyfikowane medium Dulbecco Iscove a, GIBCO-BRL, Grand Island, NY) zawierające 30% surowicy płodowej z lub bez 3 U erytropoetyny na mililitr. Barwienie immunocytochemiczne
Po 24 godzinach inkubacji w płynnej hodowli komórki erytroidalne cytowirowano na szkiełkach, utrwalano w 100 procentach etanolu i inkubowano z króliczym antyludzkim Bcl-x (to przeciwciało rozpoznaje zarówno Bcl-xL, który hamuje apoptozę, jak i Bcl-xS, który indukuje apoptoza) (Transduction Laboratories, Lexington, Ky.) lub antyludzkie Bcl-2 (Santa Cruz Laboratories, Santa Cruz, CA), jak opisano wcześniej. Komórki inkubowane z prawidłową surowicą króliczą zamiast przeciwciał pierwotnych zastosowano jako kontrolę negatywną.
Analiza przepływu-cytometrycznego
Hodowlane progenitory erytrocytów i komórki jednojądrzaste uzyskane z krwi obwodowej i szpiku kostnego kontrolnych (dawców do przeszczepu szpiku kostnego) i pacjentów z czerwienicą prawdziwą analizowano pod kątem ekspresji Bcl-x za pomocą cytometrii przepływowej, jak opisano poprzednio.14 Stosowane przeciwciała obejmowały anty-glikoforynę. Znakowane izotiocyjanianem fluoresceiny (Dako, Glostrup, Dania) i mysim anty-Bcl-x (to przeciwciało wiąże się zarówno z Bcl-xL, jak i Bcl-xS), a następnie skoniugowane z biotyną kozie antimouse IgG i streptawidyna znakowana fikoerytryną.
Analiza RT-PCR
Aby ocenić ekspresję informacyjnego RNA, stosowaliśmy RT-PCR, jak opisano wcześniej9. Komplementarny DNA wytworzono amplifikowano ze starterami swoistymi dla ludzkiego Bcl-x (5 CGGGCATTCAGTGACCTGAC3 i 5 TCAGGAACCAGCGGTTGAAG3 ). PCR składał się z denaturacji w 94 ° C przez 30 sekund, hybrydyzacji w 55 ° C przez 30 sekund i wydłużania w 72 ° C przez 30 sekund. Po 30 cyklach amplifikacji oczekiwane produkty PCR (340 bp dla Bcl-xL i 151 bp dla Bcl-xS) poddano frakcjonowaniu zależnie od wielkości na 2% żelu agarozowym i zabarwiono bromkiem etydyny.
Wyniki
Białko Bcl-x w niezależnych od erytropoetyny koloniach u pacjentów z czerwienicą prawdziwą
Figura 1. Figura 1. Ekspresja Bcl-x w komórkach erytroidalnych od pacjentów z czerwienicą prawdziwą (PV) i podmiotami kontrolnymi. Prekursory Erythroid inkubowane z erytropoetyną lub bez niej znakowano monoklonalnymi przeciwciałami anty-glikoforyną A i anty-Bcl-x. Wartości powyżej i poniżej linii poziomych wskazują procent komórek dodatnich dla glikoforyny A i Bcl-x oraz procent pozytywny dla glikoforyny A i ujemny dla Bcl-x, odpowiednio. Ćwiartki zostały sporządzone na podstawie wyników dla kontroli negatywnych z dopasowaniem izotypowym. Wszystkie wykresy punktowe pochodzą z reprezentatywnego eksperymentu przeprowadzonego w trzech powtórzeniach.
Do oceny ekspresji Bcl-x w koloniach erytroidalnych wykorzystano analizę cytometrii przepływowej komórek A glikoporfiny A, które hodowano w obecności erytropoetyny i pod jej nieobecność. Glikoporfina A jest markerem powierzchni właściwym dla erytroidów. Reprezentatywne doświadczenie pokazano na Figurze 1. Po 24 godzinach hodowli, procent komórek dodatnich dla glikoforyny A i Bcl-x w hodowlach kontrolnych wynosił 59,5 procent w obecności erytropoetyny i 13,7 procent w nieobecności erytropoetyny, podczas gdy procent komórek dodatnich dla glikoforyny A i ujemny dla Bcl-x wynosił 11,6 procent z erytropoetyną i 22,4 procent bez erytropoetyny
[więcej w: hurtownia portfeli, bikalutamid, disulfiram ]
[przypisy: urobilinogen, kątnica jelita grubego, serwatka z mleka owczego ]