Zmiany w genach NRAMP1 i podatność na gruźlicę u zachodnich Afrykanów ad

Łącznie 410 pacjentów (ponad 90 procent kwalifikujących się) udzieliło ustnej świadomej zgody. Ich średni wiek (. SD) wynosił 34,7 . 13,2 roku, a 67,4% mężczyzn. Sekwencyjni niespokrewni dawcy krwi ze szpitala Royal Victoria, Bandżul, zostali zwerbowani jako kontrolerzy. Centrum transfuzji służy obszarowi geograficznemu, z którego rekrutowano pacjentów. W sumie 417 dawców krwi (95 procent zrekrutowanych) zgodziło się wziąć udział. Wszyscy byli mężczyznami, a średni wiek wynosił 30,3 . 7,5 roku. Kontrole były retrospektywnie dopasowane do pacjentów według grup etnicznych, o ile pozwalają na to liczby. Badanie zostało zatwierdzone przez wspólny komitet etyczny rządu Gambii i Radę ds. Badań Medycznych.
Reprezentowane były następujące grupy etniczne: Mandinka (stanowiąca 38,5% pacjentów z gruźlicą i 37,4% kontroli), Wolof (19,1 i 18,4%), Jola (17,9 i 16,9%), Fula (12,0 i 12,2%), Manjago (2,5 i 3,3 procent), Serrahule (2,7 i 3,8 procent) oraz inne, mniej popularne grupy, takie jak Aku i Serere (7,3 i 8,0 procent). Te grupy etniczne były wcześniej blisko spokrewnione genetycznie. Nie uwzględniono osób, o których wiadomo, że pochodzą z regionów spoza Gambii.
Pacjenci zakażeni HIV nie byli rekrutowani, a 95 procent pacjentów, którzy zgodzili się wziąć udział w badaniu, przebadano na obecność przeciwciał przeciwko HIV. Pacjenci HIV-dodatni zostali wykluczeni. Wszystkie kontrole były ujemne pod względem HIV. Łączna częstość występowania typów HIV i 2 w Gambii jest stosunkowo niska, około 1,5% w populacji ogólnej i mniej niż 10% wśród pacjentów z gruźlicą (dane niepublikowane).
Genotypowanie NRAMP1
Typowane polimorfizmy NRAMP1 były mikrosatelitem (CA) n w bezpośrednim regionie 5 genu, 17 oznaczonym tu 5 (CA) n; zmiana pojedynczego nukleotydu w intronie 4 (469 + 14G / C), 18 oznaczonym tutaj INT4; niekonserwatywne podstawienie pojedynczej zasady w kodonie 543, które zmienia kwas asparaginowy w asparaginę (D543N) 18; i delecję TGTG w regionie 3 nieulegającym translacji (1729 + 55 del4), 18 oznaczono tu 3 UTR. DNA ekstrahowano z całej krwi żylnej przy użyciu zestawu Nucleon II (Scotlab).
Region o wielkości około 200 par zasad otaczający mikrosatelity (CA) n amplifikowano za pomocą reakcji łańcuchowej polimerazy (PCR) z użyciem starterów 5 ACTCGCATTAGGCCAACGAG3 i znakowanych fluoresceiną 5 TTCTGTGCCTCCCA-AGTTAGC3 (opracowanych przez Johna Todda). i współpracownicy, Oxford, Wielka Brytania). Produkty PCR genotypowano za pomocą elektroforezy na 6% żelach poliakryloamidowych, przy użyciu sekwencera ABI 373 i oprogramowania komputerowego Genescan i Genotyper (Perkin-Elmer) .21 Startery do PCR dla polimorfizmu INT4 to 5 CTCTGGCTGAAGGCTCTCC3 i 5 TGTGCTATCAGTTGAGCCTC3 ; startery dla D543N i 3 UTR były 5 GCATCTCCCCAATTCATGGT3 i 5 AACTGTCCCACTCTATCCTG3 .18 Substytucje pojedynczej zasady i delecja 4-bp zostały wykryte przez produkt PCR typu slot-blot do membrany nylonowej, hybrydyzacja ze specyficzną dla digoksygeniny sekwencją oligonukleotydy i detekcja sygnału za pomocą układu chemiluminescencyjnego przeciw antygenoksynie-przeciwciało (Boehringer Mannheim)
[przypisy: bikalutamid, amiodaron, diklofenak ]
[podobne: acetylowany adypinian diskrobiowy, aktualne wystepowanie grzybow, alfa pvp skutki uboczne ]